Transcript: Mouse NM_144527.3

Mus musculus centrosomal protein 85 (Cep85), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Cep85 (70012)
Length:
3878
CDS:
160..2445

Additional Resources:

NCBI RefSeq record:
NM_144527.3
NBCI Gene record:
Cep85 (70012)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_144527.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000250446 GTTCGGAGCACCTAAGATAAA pLKO_005 3315 3UTR 100% 13.200 18.480 N Cep85 n/a
2 TRCN0000250447 GCCATGCTAGAGACGTTATAC pLKO_005 730 CDS 100% 13.200 10.560 N Cep85 n/a
3 TRCN0000137501 CCATGTGATGCCTTCTACTTT pLKO.1 432 CDS 100% 5.625 4.500 N CEP85 n/a
4 TRCN0000173443 CACAATCCTAACCTCTCACTA pLKO.1 2248 CDS 100% 4.950 3.960 N Cep85 n/a
5 TRCN0000194445 GCAGTTGGAATTGATCCGTTT pLKO.1 1020 CDS 100% 4.050 3.240 N Cep85 n/a
6 TRCN0000229267 AGGGTCAAAGGTCGTGATAAA pLKO_005 1495 CDS 100% 13.200 9.240 N CEP85 n/a
7 TRCN0000250448 AGGGTCAAAGGTCGTGATAAA pLKO_005 1495 CDS 100% 13.200 9.240 N Cep85 n/a
8 TRCN0000258065 CAGCTTAAGGACGCTGAATTA pLKO_005 1648 CDS 100% 13.200 9.240 N Cep85 n/a
9 TRCN0000175441 CCTGTATGTATGAGGAGTAAA pLKO.1 3490 3UTR 100% 13.200 9.240 N Cep85 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_144527.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12495 pDONR223 100% 22.3% 21.6% None (many diffs) n/a
2 ccsbBroad304_12495 pLX_304 0% 22.3% 21.6% V5 (many diffs) n/a
Download CSV