Transcript: Mouse NM_144553.2

Mus musculus discs, large (Drosophila) homolog-associated protein 5 (Dlgap5), mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Dlgap5 (218977)
Length:
2966
CDS:
301..2727

Additional Resources:

NCBI RefSeq record:
NM_144553.2
NBCI Gene record:
Dlgap5 (218977)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_144553.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000089133 CATTCAGTGCTCGCCTTTAAT pLKO.1 2791 3UTR 100% 15.000 21.000 N Dlgap5 n/a
2 TRCN0000309776 CATTCAGTGCTCGCCTTTAAT pLKO_005 2791 3UTR 100% 15.000 21.000 N Dlgap5 n/a
3 TRCN0000089136 GCGAAACAGACACTTCGGTTT pLKO.1 420 CDS 100% 4.050 5.670 N Dlgap5 n/a
4 TRCN0000309698 GCGAAACAGACACTTCGGTTT pLKO_005 420 CDS 100% 4.050 5.670 N Dlgap5 n/a
5 TRCN0000089135 GCAGGAATGTTCCTAAAGCAA pLKO.1 800 CDS 100% 3.000 2.400 N Dlgap5 n/a
6 TRCN0000309697 GCAGGAATGTTCCTAAAGCAA pLKO_005 800 CDS 100% 3.000 2.400 N Dlgap5 n/a
7 TRCN0000089134 GCCATAAAGAATGCAATGAAA pLKO.1 1972 CDS 100% 5.625 3.938 N Dlgap5 n/a
8 TRCN0000309810 GCCATAAAGAATGCAATGAAA pLKO_005 1972 CDS 100% 5.625 3.938 N Dlgap5 n/a
9 TRCN0000089137 CTTCTGAACGTCGTTCTCAAA pLKO.1 2120 CDS 100% 4.950 3.465 N Dlgap5 n/a
10 TRCN0000309699 CTTCTGAACGTCGTTCTCAAA pLKO_005 2120 CDS 100% 4.950 3.465 N Dlgap5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_144553.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.