Transcript: Human NM_144646.4

Homo sapiens joining chain of multimeric IgA and IgM (JCHAIN), mRNA.

Source:
NCBI, updated 2019-09-22
Taxon:
Homo sapiens (human)
Gene:
JCHAIN (3512)
Length:
1286
CDS:
19..498

Additional Resources:

NCBI RefSeq record:
NM_144646.4
NBCI Gene record:
JCHAIN (3512)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_144646.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000425256 ATGTAAGTGTGCCCGGATTAC pLKO_005 120 CDS 100% 10.800 15.120 N JCHAIN n/a
2 TRCN0000147470 CAATTATCATGCTCACCTGAA pLKO.1 727 3UTR 100% 4.050 3.240 N JCHAIN n/a
3 TRCN0000435306 GCATAAACATAGGTCAATTAT pLKO_005 968 3UTR 100% 15.000 10.500 N JCHAIN n/a
4 TRCN0000416370 GCCTGCTATCCTGACTAATTT pLKO_005 481 CDS 100% 15.000 10.500 N JCHAIN n/a
5 TRCN0000428302 AGAGAAACATCCGAATTATTG pLKO_005 188 CDS 100% 13.200 9.240 N JCHAIN n/a
6 TRCN0000420868 TCACTGTGTAGAGAACATATA pLKO_005 946 3UTR 100% 13.200 9.240 N JCHAIN n/a
7 TRCN0000146551 CAGAGCAATATCTGTGATGAA pLKO.1 346 CDS 100% 4.950 3.465 N JCHAIN n/a
8 TRCN0000183059 CTGCTACACTTATGACAGAAA pLKO.1 384 CDS 100% 4.950 3.465 N JCHAIN n/a
9 TRCN0000147646 GAAGATCCTAATGAGGACATT pLKO.1 163 CDS 100% 4.950 3.465 N JCHAIN n/a
10 TRCN0000148227 GCTCTCTTAGGAATACAGTTT pLKO.1 756 3UTR 100% 4.950 3.465 N JCHAIN n/a
11 TRCN0000180648 CCTCACCATTGAGAACCAGAT pLKO.1 245 CDS 100% 4.050 2.835 N JCHAIN n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_144646.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06434 pDONR223 95.9% 100% 100% None n/a
Download CSV