Transcript: Human NM_144650.3

Homo sapiens alcohol dehydrogenase iron containing 1 (ADHFE1), mRNA.

Source:
NCBI, updated 2019-05-14
Taxon:
Homo sapiens (human)
Gene:
ADHFE1 (137872)
Length:
1972
CDS:
14..1417

Additional Resources:

NCBI RefSeq record:
NM_144650.3
NBCI Gene record:
ADHFE1 (137872)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_144650.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000220911 CCCAATTTCAGGTTTAGTGAA pLKO.1 1015 CDS 100% 4.950 6.930 N ADHFE1 n/a
2 TRCN0000220909 GCTGTCAGAAATCCCGATGAT pLKO.1 902 CDS 100% 4.950 6.930 N ADHFE1 n/a
3 TRCN0000220912 CCGGAAATTCTTATTCGATCT pLKO.1 1234 CDS 100% 4.050 5.670 N ADHFE1 n/a
4 TRCN0000436103 AGATGGCTGTTTCAAATATTA pLKO_005 156 CDS 100% 15.000 10.500 N ADHFE1 n/a
5 TRCN0000220910 GACACCTGTAAGGCTGCTAAT pLKO.1 443 CDS 100% 10.800 7.560 N ADHFE1 n/a
6 TRCN0000220908 GCAAAGGATTACAATGTGGAT pLKO.1 1046 CDS 100% 2.640 1.848 N ADHFE1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_144650.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.