Transcript: Human NM_144653.5

Homo sapiens NACC family member 2 (NACC2), mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
NACC2 (138151)
Length:
6903
CDS:
161..1924

Additional Resources:

NCBI RefSeq record:
NM_144653.5
NBCI Gene record:
NACC2 (138151)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_144653.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000229266 CCTATGCAGGGACCTTGTAAG pLKO_005 1905 CDS 100% 10.800 15.120 N NACC2 n/a
2 TRCN0000180564 GTACGGCCAGATGTACATCAA pLKO.1 1006 CDS 100% 4.950 6.930 N NACC2 n/a
3 TRCN0000229264 GTGTTCGAGCAACGCATCTAC pLKO_005 1628 CDS 100% 4.950 6.930 N NACC2 n/a
4 TRCN0000229265 TGAGAACTGACGCCGTGAATG pLKO_005 1686 CDS 100% 10.800 7.560 N NACC2 n/a
5 TRCN0000229263 CTCATCAGCCAGATCGGATAC pLKO_005 1130 CDS 100% 6.000 4.200 N NACC2 n/a
6 TRCN0000183704 GAAATTGTACTGTCAGAACTT pLKO.1 1411 CDS 100% 4.950 3.465 N NACC2 n/a
7 TRCN0000218660 TGAACGCTGTGAAATTGTACT pLKO_005 1401 CDS 100% 4.950 3.465 N NACC2 n/a
8 TRCN0000181213 CCACCTTCTTTGACAGGAACA pLKO.1 1302 CDS 100% 4.050 2.835 N NACC2 n/a
9 TRCN0000181180 CCGAGTAAAGCATGAAGCCAT pLKO.1 673 CDS 100% 2.640 1.848 N NACC2 n/a
10 TRCN0000241084 AGAGCGAGATGAACGTGATTG pLKO_005 1449 CDS 100% 10.800 8.640 N Nacc2 n/a
11 TRCN0000241083 ATGTGTCCATCGTGGTCAAAG pLKO_005 252 CDS 100% 10.800 7.560 N Nacc2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_144653.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.