Transcript: Human NM_144726.2

Homo sapiens ring finger protein 145 (RNF145), transcript variant 2, mRNA.

Source:
NCBI, updated 2018-06-25
Taxon:
Homo sapiens (human)
Gene:
RNF145 (153830)
Length:
3379
CDS:
28..2103

Additional Resources:

NCBI RefSeq record:
NM_144726.2
NBCI Gene record:
RNF145 (153830)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_144726.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000034121 GCAGGGTTATCGAGCTTTCAT pLKO.1 1008 CDS 100% 5.625 7.875 N RNF145 n/a
2 TRCN0000034120 CCTCTCTCTATGAATCGGTTT pLKO.1 460 CDS 100% 4.050 5.670 N RNF145 n/a
3 TRCN0000430163 CATTGCCAGACGACCAGATAA pLKO_005 2007 CDS 100% 13.200 10.560 N RNF145 n/a
4 TRCN0000429162 AGAAGTAGCCTTAGTAATAAC pLKO_005 229 CDS 100% 13.200 9.240 N RNF145 n/a
5 TRCN0000436176 ATGCATTATGTAGGTTATATC pLKO_005 283 CDS 100% 13.200 9.240 N RNF145 n/a
6 TRCN0000423175 CTGACATTCCAAGGATCTAAT pLKO_005 2211 3UTR 100% 13.200 9.240 N RNF145 n/a
7 TRCN0000034119 AGGTGATTATTGAGTCTTGTA pLKO.1 2606 3UTR 100% 4.950 3.465 N RNF145 n/a
8 TRCN0000034122 CTTTGGAGAATGGACAGTGAT pLKO.1 1545 CDS 100% 4.950 3.465 N RNF145 n/a
9 TRCN0000034123 GCAGCACTCCTTACTCTCTTT pLKO.1 923 CDS 100% 4.950 3.465 N RNF145 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_144726.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09703 pDONR223 100% 95.8% 95.5% None (many diffs) n/a
2 ccsbBroad304_09703 pLX_304 0% 95.8% 95.5% V5 (many diffs) n/a
Download CSV