Transcript: Mouse NM_144809.2

Mus musculus PR domain containing 9 (Prdm9), mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Prdm9 (213389)
Length:
3460
CDS:
23..2566

Additional Resources:

NCBI RefSeq record:
NM_144809.2
NBCI Gene record:
Prdm9 (213389)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_144809.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000085194 CCTCCCTTGAAGAAGGAAATA pLKO.1 492 CDS 100% 13.200 9.240 N Prdm9 n/a
2 TRCN0000085193 GCTGATTACCAAGGGAAGAAA pLKO.1 913 CDS 100% 5.625 3.938 N Prdm9 n/a
3 TRCN0000085196 CAGGATGATGACTATCTCTAT pLKO.1 626 CDS 100% 4.950 3.465 N Prdm9 n/a
4 TRCN0000085197 CTGGGCTAAGAATTAGTCCAT pLKO.1 765 CDS 100% 2.640 1.848 N Prdm9 n/a
5 TRCN0000085195 GCCTTTCAATATCACAGGAAA pLKO.1 1028 CDS 100% 4.950 2.970 N Prdm9 n/a
6 TRCN0000015176 GCTATGAGTATGTGGATGGAA pLKO.1 936 CDS 100% 3.000 2.100 N PRDM7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_144809.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.