Transcript: Mouse NM_144824.2

Mus musculus WD repeat containing, antisense to Trp53 (Wrap53), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Wrap53 (216853)
Length:
1896
CDS:
273..1871

Additional Resources:

NCBI RefSeq record:
NM_144824.2
NBCI Gene record:
Wrap53 (216853)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_144824.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000217565 GATAATGTCCTTCGGATTTAC pLKO.1 792 CDS 100% 13.200 18.480 N Wrap53 n/a
2 TRCN0000328526 TGATAATGTCCTTCGGATTTA pLKO_005 791 CDS 100% 13.200 18.480 N Wrap53 n/a
3 TRCN0000216152 CTATGATTACTGCTGGTATTC pLKO.1 902 CDS 100% 10.800 15.120 N Wrap53 n/a
4 TRCN0000298500 CTATGATTACTGCTGGTATTC pLKO_005 902 CDS 100% 10.800 15.120 N WRAP53 n/a
5 TRCN0000181754 GACCACTAATCAGCGCATCTA pLKO.1 1457 CDS 100% 4.950 6.930 N Wrap53 n/a
6 TRCN0000328586 GACCACTAATCAGCGCATCTA pLKO_005 1457 CDS 100% 4.950 6.930 N Wrap53 n/a
7 TRCN0000197461 CCAGAATTGTACAGTGAACAA pLKO.1 822 CDS 100% 4.950 3.465 N Wrap53 n/a
8 TRCN0000198445 GAGGAGCAAGATGTTTCTGAA pLKO.1 531 CDS 100% 4.950 3.465 N Wrap53 n/a
9 TRCN0000328585 GAGGAGCAAGATGTTTCTGAA pLKO_005 531 CDS 100% 4.950 3.465 N Wrap53 n/a
10 TRCN0000198352 GATTCACATCTGGGATGCATT pLKO.1 983 CDS 100% 4.950 3.465 N Wrap53 n/a
11 TRCN0000198458 GTTTCTGAACATGCGAGTCTT pLKO.1 543 CDS 100% 4.950 3.465 N Wrap53 n/a
12 TRCN0000328525 GTTTCTGAACATGCGAGTCTT pLKO_005 543 CDS 100% 4.950 3.465 N Wrap53 n/a
13 TRCN0000328587 GTACCTCTGGAAGTAGAATTT pLKO_005 480 CDS 100% 0.000 0.000 N Wrap53 n/a
14 TRCN0000176823 GAACTTCTTGAAAGGTTGCAA pLKO.1 731 CDS 100% 3.000 1.800 N Wrap53 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_144824.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.