Transcript: Mouse NM_144825.2

Mus musculus TAO kinase 1 (Taok1), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Taok1 (216965)
Length:
12411
CDS:
699..3704

Additional Resources:

NCBI RefSeq record:
NM_144825.2
NBCI Gene record:
Taok1 (216965)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Clone ID Target Seq Vector PAM Seq Cut Position Cut % of CDS Length Exon On Target Score[?] Other Matching Genes Orig. Target Gene[?] Notes Addgene[?]
1 BRDN0001145897 GAAATAGCAGCAATTACACA pXPR_003 TGG 395 13% 6 0.3631 Taok1 TAOK1 76807
Download CSV

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_144825.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000037528 CGAGTGTCACTTCACAAATAT pLKO.1 3655 CDS 100% 15.000 21.000 N TAOK1 n/a
2 TRCN0000333380 CGAGTGTCACTTCACAAATAT pLKO_005 3655 CDS 100% 15.000 21.000 N TAOK1 n/a
3 TRCN0000079093 GCCATTTACAAGTGGAAATAA pLKO.1 7144 3UTR 100% 15.000 21.000 N Taok1 n/a
4 TRCN0000349779 GCACGAGATGTGCGTACTAAT pLKO_005 831 CDS 100% 13.200 18.480 N Taok1 n/a
5 TRCN0000079094 GCGCCCTGAAACAGTGTTAAT pLKO.1 1550 CDS 100% 13.200 18.480 N Taok1 n/a
6 TRCN0000311972 GCGCCCTGAAACAGTGTTAAT pLKO_005 1550 CDS 100% 13.200 18.480 N Taok1 n/a
7 TRCN0000037525 CCCAACAGTATAGAATACAAA pLKO.1 954 CDS 100% 5.625 7.875 N TAOK1 n/a
8 TRCN0000333306 CCCAACAGTATAGAATACAAA pLKO_005 954 CDS 100% 5.625 7.875 N TAOK1 n/a
9 TRCN0000079097 CGGCTCAGATTAGACAAAGAT pLKO.1 2175 CDS 100% 5.625 7.875 N Taok1 n/a
10 TRCN0000312883 ACAAGTCACATTATCGTAATA pLKO_005 1981 CDS 100% 13.200 9.240 N Taok1 n/a
11 TRCN0000312884 TAATTGGGATGTCATAGTATT pLKO_005 3859 3UTR 100% 13.200 9.240 N Taok1 n/a
12 TRCN0000079095 CCATCTCAACACTATTCAGAA pLKO.1 2693 CDS 100% 4.950 3.465 N Taok1 n/a
13 TRCN0000079096 GACTCGAAAGTTAGCCATCTT pLKO.1 2990 CDS 100% 4.950 3.465 N Taok1 n/a
14 TRCN0000311973 GACTCGAAAGTTAGCCATCTT pLKO_005 2990 CDS 100% 4.950 3.465 N Taok1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_144825.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.