Transcript: Mouse NM_144828.2

Mus musculus protein phosphatase 1, regulatory (inhibitor) subunit 1B (Ppp1r1b), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-11
Taxon:
Mus musculus (mouse)
Gene:
Ppp1r1b (19049)
Length:
2017
CDS:
689..1273

Additional Resources:

NCBI RefSeq record:
NM_144828.2
NBCI Gene record:
Ppp1r1b (19049)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_144828.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000105956 CATTAGCAACTTGAGTGAGAA pLKO.1 949 CDS 100% 4.950 3.465 N Ppp1r1b n/a
2 TRCN0000105955 CCTCCTTTGTACCCTGTCTTT pLKO.1 1346 3UTR 100% 4.950 3.465 N Ppp1r1b n/a
3 TRCN0000105957 CCCAAAGTCGAAGAGACCCAA pLKO.1 877 CDS 100% 2.640 1.848 N Ppp1r1b n/a
4 TRCN0000105959 AGATGGAAACTCTGAGGACCA pLKO.1 1189 CDS 100% 2.160 1.512 N Ppp1r1b n/a
5 TRCN0000105958 TGGAAGGCAGAGCAACACTAA pLKO.1 1212 CDS 100% 4.950 2.970 N Ppp1r1b n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_144828.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04336 pDONR223 100% 65.9% 65.3% None (many diffs) n/a
2 ccsbBroad304_04336 pLX_304 0% 65.9% 65.3% V5 (many diffs) n/a
Download CSV