Transcript: Mouse NM_144854.2

Mus musculus Map3k7 C-terminal like (Map3k7cl), mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Map3k7cl (224419)
Length:
1652
CDS:
306..734

Additional Resources:

NCBI RefSeq record:
NM_144854.2
NBCI Gene record:
Map3k7cl (224419)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_144854.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000078960 CGCATCGCGTTTAGCCTCAAT pLKO.1 345 CDS 100% 4.950 6.930 N Map3k7cl n/a
2 TRCN0000078961 GCACTGCCAAATAGCAGAAGA pLKO.1 488 CDS 100% 4.950 6.930 N Map3k7cl n/a
3 TRCN0000078958 CCGTTGAGTGAATGCAGAATT pLKO.1 1505 3UTR 100% 0.000 0.000 N Map3k7cl n/a
4 TRCN0000078962 GCTCAGCTGGTTCAGGAATTT pLKO.1 606 CDS 100% 13.200 9.240 N Map3k7cl n/a
5 TRCN0000453200 ACACACATTTATCTTAGTTAG pLKO_005 1003 3UTR 100% 10.800 7.560 N Map3k7cl n/a
6 TRCN0000078959 CTGCCAAATAGCAGAAGAGTA pLKO.1 491 CDS 100% 4.950 2.970 N Map3k7cl n/a
7 TRCN0000078647 ACTGCCAAATAGCAGAAGAAT pLKO.1 490 CDS 100% 5.625 3.375 N MAP3K7CL n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_144854.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.