Transcript: Mouse NM_144862.3

Mus musculus LIM and senescent cell antigen like domains 2 (Lims2), mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Lims2 (225341)
Length:
1688
CDS:
34..1059

Additional Resources:

NCBI RefSeq record:
NM_144862.3
NBCI Gene record:
Lims2 (225341)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_144862.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000366118 TGGACGTCAACTCACTCTAAA pLKO_005 1040 CDS 100% 13.200 18.480 N Lims2 n/a
2 TRCN0000112647 CCCGTGTGTAAGAGGTGCTAT pLKO.1 940 CDS 100% 4.950 3.960 N Lims2 n/a
3 TRCN0000366195 CAAACTGGAGCAGGATTATTT pLKO_005 1284 3UTR 100% 15.000 10.500 N Lims2 n/a
4 TRCN0000376691 GCGGATTCTGTGGTGAATTTG pLKO_005 260 CDS 100% 13.200 9.240 N Lims2 n/a
5 TRCN0000366194 AGGGACTCTTCTACGAGTTTG pLKO_005 188 CDS 100% 10.800 7.560 N Lims2 n/a
6 TRCN0000366193 CAAGTTTGTGGAGTTCGATAT pLKO_005 915 CDS 100% 10.800 7.560 N Lims2 n/a
7 TRCN0000374535 CCCACTACAACCAGCTCTTTG pLKO_005 773 CDS 100% 10.800 7.560 N Lims2 n/a
8 TRCN0000374592 GAGAAGAAGGGCCTAGCATAC pLKO_005 745 CDS 100% 6.000 4.200 N Lims2 n/a
9 TRCN0000374536 CCAAGGGCTTGGGCAAATTCA pLKO_005 428 CDS 100% 5.625 3.938 N Lims2 n/a
10 TRCN0000112645 GAGCAGGATTATTTGTCACTT pLKO.1 1291 3UTR 100% 4.950 3.465 N Lims2 n/a
11 TRCN0000112646 GCTCACTCTAAAGAACAAGTT pLKO.1 900 CDS 100% 4.950 3.465 N Lims2 n/a
12 TRCN0000112649 GCACAGTGCTTCCGGCCATTT pLKO.1 163 CDS 100% 3.600 2.520 N Lims2 n/a
13 TRCN0000112648 CATGTTCAAGAATGATCCCTA pLKO.1 489 CDS 100% 2.640 1.848 N Lims2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_144862.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.