Transcript: Mouse NM_144866.3

Mus musculus eukaryotic translation termination factor 1 (Etf1), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Etf1 (225363)
Length:
3718
CDS:
189..1502

Additional Resources:

NCBI RefSeq record:
NM_144866.3
NBCI Gene record:
Etf1 (225363)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_144866.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000191439 CATAACTATGTTCGGAAAGTA pLKO.1 783 CDS 100% 5.625 4.500 N Etf1 n/a
2 TRCN0000279011 CATAACTATGTTCGGAAAGTA pLKO_005 783 CDS 100% 5.625 4.500 N Etf1 n/a
3 TRCN0000190933 CGAGTTTGGAACTGCATCTAA pLKO.1 350 CDS 100% 5.625 3.938 N Etf1 n/a
4 TRCN0000279008 CGAGTTTGGAACTGCATCTAA pLKO_005 350 CDS 100% 5.625 3.938 N Etf1 n/a
5 TRCN0000201995 CCGTGAGCATTGGATACTGAA pLKO.1 1621 3UTR 100% 4.950 3.465 N Etf1 n/a
6 TRCN0000279073 CCGTGAGCATTGGATACTGAA pLKO_005 1621 3UTR 100% 4.950 3.465 N Etf1 n/a
7 TRCN0000189586 CCTCCAAATGGTCTGGTTGTT pLKO.1 453 CDS 100% 4.950 3.465 N Etf1 n/a
8 TRCN0000279074 CCTCCAAATGGTCTGGTTGTT pLKO_005 453 CDS 100% 4.950 3.465 N Etf1 n/a
9 TRCN0000139839 CCAGATTTCACGAGTGGCAAA pLKO.1 317 CDS 100% 4.050 2.835 N ETF1 n/a
10 TRCN0000142136 GCACAAATTCACTGTGGATCT pLKO.1 695 CDS 100% 4.050 2.835 N ETF1 n/a
11 TRCN0000338749 GCACAAATTCACTGTGGATCT pLKO_005 695 CDS 100% 4.050 2.835 N ETF1 n/a
12 TRCN0000140357 GCTTTGGAAATGGGAGCTGTA pLKO.1 1119 CDS 100% 4.050 2.835 N ETF1 n/a
13 TRCN0000201255 GATCACAGTTTGTGAAAGGAT pLKO.1 1384 CDS 100% 3.000 1.800 N Etf1 n/a
14 TRCN0000279007 GATCACAGTTTGTGAAAGGAT pLKO_005 1384 CDS 100% 3.000 1.800 N Etf1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_144866.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.