Transcript: Mouse NM_144899.3

Mus musculus ADAMTS-like 4 (Adamtsl4), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-04
Taxon:
Mus musculus (mouse)
Gene:
Adamtsl4 (229595)
Length:
3938
CDS:
176..3286

Additional Resources:

NCBI RefSeq record:
NM_144899.3
NBCI Gene record:
Adamtsl4 (229595)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_144899.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000080483 CGTCTCCACATCTTCTAAATT pLKO.1 3642 3UTR 100% 15.000 21.000 N Adamtsl4 n/a
2 TRCN0000080485 CGTCTATATGATCTTTCAAGA pLKO.1 1810 CDS 100% 4.950 6.930 N Adamtsl4 n/a
3 TRCN0000080486 CGATTCTATGTCCGACACACT pLKO.1 1349 CDS 100% 2.640 3.696 N Adamtsl4 n/a
4 TRCN0000080487 GTTCGGTGTGTTGGCAGTAAT pLKO.1 2489 CDS 100% 13.200 10.560 N Adamtsl4 n/a
5 TRCN0000080484 CACACAACACAGAGACATTAT pLKO.1 2848 CDS 100% 13.200 7.920 N Adamtsl4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_144899.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.