Transcript: Human NM_144976.4

Homo sapiens zinc finger protein 564 (ZNF564), mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
ZNF564 (163050)
Length:
2885
CDS:
151..1812

Additional Resources:

NCBI RefSeq record:
NM_144976.4
NBCI Gene record:
ZNF564 (163050)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_144976.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000018284 CCTAGTTCTGTCCGAACACAT pLKO.1 1531 CDS 100% 4.950 6.930 N ZNF564 n/a
2 TRCN0000425013 GAATTGAGTCTCATCCATATC pLKO_005 2029 3UTR 100% 10.800 8.640 N ZNF564 n/a
3 TRCN0000018283 CGCCCAAGTTTATTTCAGATA pLKO.1 772 CDS 100% 4.950 3.960 N ZNF564 n/a
4 TRCN0000018286 CCCAGTTATGTTCGAAAGCAT pLKO.1 1111 CDS 100% 3.000 2.400 N ZNF564 n/a
5 TRCN0000417881 TTATCACACAACCTTCGAATA pLKO_005 1775 CDS 100% 10.800 7.560 N ZNF564 n/a
6 TRCN0000018287 TCAGTCAGATTCTCAATCTTA pLKO.1 401 CDS 100% 5.625 3.938 N ZNF564 n/a
7 TRCN0000018285 GAATGTAGTTTGTGTGGGAAA pLKO.1 460 CDS 100% 4.050 2.430 N ZNF564 n/a
8 TRCN0000243782 TGGAGAGAAACCCTATGAATA pLKO_005 810 CDS 100% 13.200 6.600 Y Zfp977 n/a
9 TRCN0000151775 CCCTATGAATGTAAGGAATGT pLKO.1 1240 CDS 100% 4.950 2.475 Y ZNF829 n/a
10 TRCN0000117777 CGAAGACATGAAAGAACTCAT pLKO.1 619 CDS 100% 4.950 2.475 Y ZNF121 n/a
11 TRCN0000160334 CCTATGAATGTAAGGAATGTA pLKO.1 1241 CDS 100% 5.625 2.813 Y ZNF570 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_144976.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.