Transcript: Mouse NM_145079.3

Mus musculus UDP glucuronosyltransferase 1 family, polypeptide A6A (Ugt1a6a), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Ugt1a6a (94284)
Length:
3302
CDS:
129..1724

Additional Resources:

NCBI RefSeq record:
NM_145079.3
NBCI Gene record:
Ugt1a6a (94284)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_145079.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000110352 CAACATGATTGTCGTGGACAT pLKO.1 470 CDS 100% 4.050 3.240 N Ugt1a6a n/a
2 TRCN0000110353 GCCCAGATTCTACACCAAATT pLKO.1 704 CDS 100% 13.200 6.600 Y Ugt1a6a n/a
3 TRCN0000110328 CTTCACAAGGACCGTCCTATA pLKO.1 1458 CDS 100% 10.800 5.400 Y Ugt1a9 n/a
4 TRCN0000093944 CCAGTGTTAGTCATTCTTCAT pLKO.1 2078 3UTR 100% 4.950 2.475 Y Ugt1a1 n/a
5 TRCN0000110330 CCATCAGGGAAGGTTCTAGTA pLKO.1 1892 3UTR 100% 4.950 2.475 Y Ugt1a6b n/a
6 TRCN0000110325 CCTTCTCCAGTGTTAGTCATT pLKO.1 2072 3UTR 100% 4.950 2.475 Y Ugt1a9 n/a
7 TRCN0000093958 CGAGTGAAGAAATCACACAAA pLKO.1 1689 CDS 100% 4.950 2.475 Y Ugt1a5 n/a
8 TRCN0000110351 CTACCTTCCTTACACCAGAAT pLKO.1 855 CDS 100% 4.950 2.475 Y Ugt1a6a n/a
9 TRCN0000110329 CTTGAAATGACTGCTGATGAT pLKO.1 1368 CDS 100% 4.950 2.475 Y Ugt1a9 n/a
10 TRCN0000110355 GAAGGAGAAGTATTAGTTCAT pLKO.1 1740 3UTR 100% 4.950 2.475 Y Ugt1a7c n/a
11 TRCN0000110350 GTCATTCTTCATTGTGTTCAT pLKO.1 2087 3UTR 100% 4.950 2.475 Y Ugt1a6a n/a
12 TRCN0000110331 CCTACCTTCCTTACACCAGAA pLKO.1 854 CDS 100% 4.050 2.025 Y Ugt1a6b n/a
13 TRCN0000110333 CTCAAGAGAGATGTGTCCCTA pLKO.1 837 CDS 100% 2.640 1.320 Y Ugt1a6b n/a
14 TRCN0000110480 GTTAGGGAAATAATTCACCAT pLKO.1 1811 3UTR 100% 2.640 1.320 Y Ugt1a2 n/a
15 TRCN0000110345 GAAACTTGGAAACAAGTGTTA pLKO.1 1774 3UTR 100% 0.495 0.248 Y Ugt1a10 n/a
16 TRCN0000093954 CTAGTATATGTGATGTGCTTT pLKO.1 1907 3UTR 100% 0.000 0.000 Y Ugt1a5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_145079.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.