Transcript: Mouse NM_145156.1

Mus musculus solute carrier family 25, member 28 (Slc25a28), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Slc25a28 (246696)
Length:
1569
CDS:
116..1210

Additional Resources:

NCBI RefSeq record:
NM_145156.1
NBCI Gene record:
Slc25a28 (246696)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_145156.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000069609 GCCGGATGTGTGGCGACATTA pLKO.1 641 CDS 100% 4.400 6.160 N Slc25a28 n/a
2 TRCN0000069610 AGTTCCTGCAAGAGCACTTTA pLKO.1 855 CDS 100% 13.200 9.240 N Slc25a28 n/a
3 TRCN0000069608 GCATGGTCTGTGTATGAATTT pLKO.1 1139 CDS 100% 13.200 9.240 N Slc25a28 n/a
4 TRCN0000069612 CCTGGAGCATTGCGTGATGTA pLKO.1 367 CDS 100% 4.950 3.465 N Slc25a28 n/a
5 TRCN0000069611 GCAGAGGATGCAGATGTACAA pLKO.1 700 CDS 100% 4.950 3.465 N Slc25a28 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_145156.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.