Transcript: Human NM_145159.3

Homo sapiens jagged canonical Notch ligand 2 (JAG2), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
JAG2 (3714)
Length:
5659
CDS:
357..3959

Additional Resources:

NCBI RefSeq record:
NM_145159.3
NBCI Gene record:
JAG2 (3714)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_145159.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000365341 GTCGTACTTGCACTCACAATA pLKO_005 2590 CDS 100% 13.200 18.480 N JAG2 n/a
2 TRCN0000370515 CGAGGCCATGTGCATAGTTTC pLKO_005 4030 3UTR 100% 10.800 15.120 N JAG2 n/a
3 TRCN0000033422 CTCTCACACAAATTCACCAAA pLKO.1 3831 CDS 100% 4.950 3.960 N JAG2 n/a
4 TRCN0000370513 ACGTTTCTTTAACCTTGTATA pLKO_005 4103 3UTR 100% 13.200 9.240 N JAG2 n/a
5 TRCN0000365342 ATAACCTGGAGGGTGACTATT pLKO_005 1897 CDS 100% 13.200 9.240 N JAG2 n/a
6 TRCN0000365340 CAAGGTGGAGACGGTTGTTAC pLKO_005 3446 CDS 100% 10.800 7.560 N JAG2 n/a
7 TRCN0000370455 CCTACTGCCATGAGAACATTG pLKO_005 2134 CDS 100% 10.800 7.560 N JAG2 n/a
8 TRCN0000033419 GCTCTACCAGTGCAAGAACTT pLKO.1 3683 CDS 100% 4.950 3.465 N JAG2 n/a
9 TRCN0000033420 CTGTGTGTAAACAAGGGTGTA pLKO.1 1084 CDS 100% 4.050 2.835 N JAG2 n/a
10 TRCN0000033421 CGCTGCTACGACCTGGTCAAT pLKO.1 2304 CDS 100% 1.650 1.155 N JAG2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_145159.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.