Transcript: Human NM_145236.3

Homo sapiens UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 7 (B3GNT7), mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
B3GNT7 (93010)
Length:
3539
CDS:
95..1300

Additional Resources:

NCBI RefSeq record:
NM_145236.3
NBCI Gene record:
B3GNT7 (93010)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_145236.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000414808 GGTGGTTGTCAAGTCGGTCAT pLKO_005 505 CDS 100% 4.050 5.670 N B3GNT7 n/a
2 TRCN0000035529 CACTAACTGCTCAGCCAATAT pLKO.1 352 CDS 100% 13.200 10.560 N B3GNT7 n/a
3 TRCN0000035530 GCTTCAAGACTTTCGGCATCT pLKO.1 1131 CDS 100% 4.050 3.240 N B3GNT7 n/a
4 TRCN0000423862 GGACCTCCCTGTGTGGATAAT pLKO_005 1464 3UTR 100% 13.200 9.240 N B3GNT7 n/a
5 TRCN0000431770 ACCAACCTGCTAGAATTTCTG pLKO_005 836 CDS 100% 4.950 3.465 N B3GNT7 n/a
6 TRCN0000035532 CATTCGCAGGAAAGACAACAA pLKO.1 916 CDS 100% 4.950 3.465 N B3GNT7 n/a
7 TRCN0000035533 GCTCAGCCAATATCAACTTGA pLKO.1 360 CDS 100% 4.950 3.465 N B3GNT7 n/a
8 TRCN0000035531 CAACTTCTGGAAGAACCCGAA pLKO.1 271 CDS 100% 2.160 1.512 N B3GNT7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_145236.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.