Transcript: Mouse NM_145368.2

Mus musculus acyl-coenzyme A amino acid N-acyltransferase 2 (Acnat2), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Acnat2 (209186)
Length:
1659
CDS:
128..1390

Additional Resources:

NCBI RefSeq record:
NM_145368.2
NBCI Gene record:
Acnat2 (209186)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_145368.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000113201 CCATCACAATCTTCCCACTAA pLKO.1 912 CDS 100% 4.950 3.465 N Acnat2 n/a
2 TRCN0000113200 GTGTGTAAAGTGCCAGAGTAA pLKO.1 1394 3UTR 100% 4.950 3.465 N Acnat2 n/a
3 TRCN0000367185 GGTCCTTTCCCAGGAATTATT pLKO_005 599 CDS 100% 15.000 7.500 Y Acnat1 n/a
4 TRCN0000367186 TCCGGAAGCAAACTCTAAATA pLKO_005 1373 CDS 100% 15.000 7.500 Y Acnat1 n/a
5 TRCN0000376309 ACCTCATAGAGCCACCTTATT pLKO_005 1215 CDS 100% 13.200 6.600 Y Acnat1 n/a
6 TRCN0000113204 CACCTCATAGAGCCACCTTAT pLKO.1 1214 CDS 100% 10.800 5.400 Y Acnat2 n/a
7 TRCN0000113202 CCAAGCCTTCTACAAGACTAA pLKO.1 268 CDS 100% 4.950 2.475 Y Acnat2 n/a
8 TRCN0000113203 CCCAAGCCTTCTACAAGACTA pLKO.1 267 CDS 100% 4.950 2.475 Y Acnat2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_145368.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.