Transcript: Mouse NM_145380.2

Mus musculus eukaryotic translation initiation factor 3, subunit M (Eif3m), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Eif3m (98221)
Length:
1230
CDS:
41..1165

Additional Resources:

NCBI RefSeq record:
NM_145380.2
NBCI Gene record:
Eif3m (98221)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_145380.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000217740 GCGAGCTTATCCATGATTTAT pLKO.1 741 CDS 100% 15.000 21.000 N Eif3m n/a
2 TRCN0000251930 GCGAGCTTATCCATGATTTAT pLKO_005 741 CDS 100% 15.000 21.000 N Eif3m n/a
3 TRCN0000216483 GTAGATTTAGCTCAGATTATT pLKO.1 158 CDS 100% 15.000 21.000 N Eif3m n/a
4 TRCN0000251933 GTAGATTTAGCTCAGATTATT pLKO_005 158 CDS 100% 15.000 21.000 N Eif3m n/a
5 TRCN0000251932 GTGTATTGTGCGGGCACTAAA pLKO_005 658 CDS 100% 13.200 18.480 N Eif3m n/a
6 TRCN0000216564 GACCATCTTCTTACTCTAAAG pLKO.1 701 CDS 100% 10.800 8.640 N Eif3m n/a
7 TRCN0000183346 GCATCGTATGTCAAGTTCTAT pLKO.1 788 CDS 100% 5.625 4.500 N Eif3m n/a
8 TRCN0000251934 TGACCATCTTCTTACTCTAAA pLKO_005 700 CDS 100% 13.200 9.240 N Eif3m n/a
9 TRCN0000251931 GTGGAATTGCTCGGGAGTTAC pLKO_005 596 CDS 100% 10.800 6.480 N Eif3m n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_145380.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02450 pDONR223 100% 91.7% 99.4% None (many diffs) n/a
2 ccsbBroad304_02450 pLX_304 0% 91.7% 99.4% V5 (many diffs) n/a
Download CSV