Transcript: Mouse NM_145600.1

Mus musculus zinc finger protein 330 (Zfp330), mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Zfp330 (30932)
Length:
1665
CDS:
83..1033

Additional Resources:

NCBI RefSeq record:
NM_145600.1
NBCI Gene record:
Zfp330 (30932)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_145600.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000350096 ACCTGTCGTCGGACAAGTATG pLKO_005 846 CDS 100% 10.800 15.120 N Zfp330 n/a
2 TRCN0000098705 CGCAGTTTCTAGGGATGCTAT pLKO.1 1146 3UTR 100% 4.950 6.930 N Zfp330 n/a
3 TRCN0000317982 CGCAGTTTCTAGGGATGCTAT pLKO_005 1146 3UTR 100% 4.950 6.930 N Zfp330 n/a
4 TRCN0000098708 CGTCGGACAAGTATGGAGATA pLKO.1 852 CDS 100% 4.950 6.930 N Zfp330 n/a
5 TRCN0000098706 GCCCTAAATGTGGGCATGAAA pLKO.1 720 CDS 100% 5.625 4.500 N Zfp330 n/a
6 TRCN0000098707 CGGCAGAAGAATAGAGCATTT pLKO.1 224 CDS 100% 10.800 7.560 N Zfp330 n/a
7 TRCN0000318043 CGGCAGAAGAATAGAGCATTT pLKO_005 224 CDS 100% 10.800 7.560 N Zfp330 n/a
8 TRCN0000350047 GATGGAGCCTCAGGGTATGAT pLKO_005 812 CDS 100% 5.625 3.938 N Zfp330 n/a
9 TRCN0000098709 GTTTCTGTGATGAACATACAA pLKO.1 657 CDS 100% 5.625 3.938 N Zfp330 n/a
10 TRCN0000350046 GATGCAGAGTGTGTGGAATGT pLKO_005 458 CDS 100% 4.950 3.465 N Zfp330 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_145600.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.