Transcript: Human NM_145657.3

Homo sapiens GS homeobox 1 (GSX1), mRNA.

Source:
NCBI, updated 2019-06-30
Taxon:
Homo sapiens (human)
Gene:
GSX1 (219409)
Length:
1823
CDS:
209..1003

Additional Resources:

NCBI RefSeq record:
NM_145657.3
NBCI Gene record:
GSX1 (219409)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_145657.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000016978 GCGCGAGTTCGCTTCTAATAT pLKO.1 697 CDS 100% 15.000 21.000 N GSX1 n/a
2 TRCN0000418459 GAGATCGCGACCTACCTGAAT pLKO_005 743 CDS 100% 4.950 6.930 N GSX1 n/a
3 TRCN0000016980 CGCGCTCTACCAGACCTCCTA pLKO.1 559 CDS 100% 0.000 0.000 N GSX1 n/a
4 TRCN0000016979 CTACCTGAATCTGTCCGAGAA pLKO.1 754 CDS 100% 4.050 2.835 N GSX1 n/a
5 TRCN0000016981 GTTCGCTTCTAATATGTACCT pLKO.1 703 CDS 100% 2.640 1.848 N GSX1 n/a
6 TRCN0000420556 TGGACAGCAGCTCTAACCAGC pLKO_005 618 CDS 100% 0.720 0.504 N GSX1 n/a
7 TRCN0000016982 GCTGCCCAGCAGCAAGAGGAT pLKO.1 637 CDS 100% 0.000 0.000 N GSX1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_145657.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.