Transcript: Human NM_145728.3

Homo sapiens synemin (SYNM), transcript variant A, mRNA.

Source:
NCBI, updated 2019-06-30
Taxon:
Homo sapiens (human)
Gene:
SYNM (23336)
Length:
7353
CDS:
121..4818

Additional Resources:

NCBI RefSeq record:
NM_145728.3
NBCI Gene record:
SYNM (23336)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_145728.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000314854 TAGACCAAAGGTCGGTGATTT pLKO_005 4727 CDS 100% 13.200 10.560 N SYNM n/a
2 TRCN0000005119 CGCTTACAGTACCATTTCATT pLKO.1 5537 3UTR 100% 5.625 4.500 N SYNM n/a
3 TRCN0000314797 CGCTTACAGTACCATTTCATT pLKO_005 5537 3UTR 100% 5.625 4.500 N SYNM n/a
4 TRCN0000005121 GCAGGCCATGTTTGATAAGAA pLKO.1 4686 CDS 100% 5.625 3.938 N SYNM n/a
5 TRCN0000005120 GCGATGTCACATTCTCAGTTA pLKO.1 2498 CDS 100% 4.950 3.465 N SYNM n/a
6 TRCN0000005122 GCCGTCAGAATTCAGAAACAA pLKO.1 1119 CDS 100% 0.000 0.000 N SYNM n/a
7 TRCN0000314851 GCCGTCAGAATTCAGAAACAA pLKO_005 1119 CDS 100% 0.000 0.000 N SYNM n/a
8 TRCN0000314855 TCGGAAAGCACACGGTCAAAT pLKO_005 1570 CDS 100% 13.200 7.920 N SYNM n/a
9 TRCN0000005123 GCTGAAGTCAACGTCTCACAA pLKO.1 3121 CDS 100% 4.950 2.970 N SYNM n/a
10 TRCN0000314852 GCTGAAGTCAACGTCTCACAA pLKO_005 3121 CDS 100% 4.950 2.970 N SYNM n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_145728.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.