Transcript: Mouse NM_145925.2

Mus musculus pituitary tumor-transforming 1 interacting protein (Pttg1ip), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Pttg1ip (108705)
Length:
2275
CDS:
56..580

Additional Resources:

NCBI RefSeq record:
NM_145925.2
NBCI Gene record:
Pttg1ip (108705)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_145925.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000098290 GCCCTGATGAACTTCGTATTA pLKO.1 2022 3UTR 100% 13.200 18.480 N Pttg1ip n/a
2 TRCN0000324619 GCCCTGATGAACTTCGTATTA pLKO_005 2022 3UTR 100% 13.200 18.480 N Pttg1ip n/a
3 TRCN0000098294 CTTCTCTCTGTAAATTGAGTT pLKO.1 279 CDS 100% 4.950 3.465 N Pttg1ip n/a
4 TRCN0000324536 CTTCTCTCTGTAAATTGAGTT pLKO_005 279 CDS 100% 4.950 3.465 N Pttg1ip n/a
5 TRCN0000098291 GCGGAAATGAAGTCAAGACAT pLKO.1 500 CDS 100% 4.950 3.465 N Pttg1ip n/a
6 TRCN0000324618 GCGGAAATGAAGTCAAGACAT pLKO_005 500 CDS 100% 4.950 3.465 N Pttg1ip n/a
7 TRCN0000098293 GCTCTGAGTACACAAACAGAT pLKO.1 165 CDS 100% 4.950 3.465 N Pttg1ip n/a
8 TRCN0000324617 GCTCTGAGTACACAAACAGAT pLKO_005 165 CDS 100% 4.950 3.465 N Pttg1ip n/a
9 TRCN0000098292 GCAATGAGAACAAGGCGTGTA pLKO.1 225 CDS 100% 4.050 2.835 N Pttg1ip n/a
10 TRCN0000324538 GCAATGAGAACAAGGCGTGTA pLKO_005 225 CDS 100% 4.050 2.835 N Pttg1ip n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_145925.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.