Transcript: Mouse NM_145935.3

Mus musculus glycine-N-acyltransferase (Glyat), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Glyat (107146)
Length:
1310
CDS:
314..1204

Additional Resources:

NCBI RefSeq record:
NM_145935.3
NBCI Gene record:
Glyat (107146)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_145935.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000103391 CCATTGATCAAGACAAGTTTA pLKO.1 798 CDS 100% 13.200 18.480 N Glyat n/a
2 TRCN0000335165 CCATTGATCAAGACAAGTTTA pLKO_005 798 CDS 100% 13.200 18.480 N Glyat n/a
3 TRCN0000103394 ACCTGAATAAGACGATACAAA pLKO.1 642 CDS 100% 5.625 7.875 N Glyat n/a
4 TRCN0000103392 CACCTGAATAAGACGATACAA pLKO.1 641 CDS 100% 5.625 7.875 N Glyat n/a
5 TRCN0000335164 CACCTGAATAAGACGATACAA pLKO_005 641 CDS 100% 5.625 7.875 N Glyat n/a
6 TRCN0000103390 GCCATTGATCAAGACAAGTTT pLKO.1 797 CDS 100% 5.625 7.875 N Glyat n/a
7 TRCN0000103393 GATTATGACAAAGCGTGGTTA pLKO.1 1069 CDS 100% 4.950 3.465 N Glyat n/a
8 TRCN0000335166 GATTATGACAAAGCGTGGTTA pLKO_005 1069 CDS 100% 4.950 3.465 N Glyat n/a
9 TRCN0000348416 ATTCATTGAACGCTGCATAAA pLKO_005 898 CDS 100% 13.200 7.920 N Glyat n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_145935.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.