Transcript: Mouse NM_145960.4

Mus musculus mitochondrial translational release factor 1 (Mtrf1), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Mtrf1 (211253)
Length:
1862
CDS:
382..1722

Additional Resources:

NCBI RefSeq record:
NM_145960.4
NBCI Gene record:
Mtrf1 (211253)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_145960.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000248451 ATGATTGGAGTGACGTTATTC pLKO_005 923 CDS 100% 13.200 18.480 N Mtrf1 n/a
2 TRCN0000248449 CAACAGTTTACCCGGGAAATA pLKO_005 985 CDS 100% 13.200 18.480 N Mtrf1 n/a
3 TRCN0000200636 CGTATGAAGTTCGTGACATTA pLKO.1 1586 CDS 100% 13.200 18.480 N Mtrf1 n/a
4 TRCN0000248452 CGTATGAAGTTCGTGACATTA pLKO_005 1586 CDS 100% 13.200 18.480 N Mtrf1 n/a
5 TRCN0000192146 GATCTGCGAGTAGACACATTT pLKO.1 1279 CDS 100% 13.200 18.480 N Mtrf1 n/a
6 TRCN0000257553 AGTGCCTGGATCAGCTAATTG pLKO_005 1628 CDS 100% 13.200 9.240 N Mtrf1 n/a
7 TRCN0000191857 GAACAAGCCATTGAAGAATTA pLKO.1 763 CDS 100% 13.200 9.240 N Mtrf1 n/a
8 TRCN0000248450 TGATACAAGGCCGTGGAATTT pLKO_005 486 CDS 100% 13.200 9.240 N Mtrf1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_145960.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.