Transcript: Mouse NM_146109.3

Mus musculus amyotrophic lateral sclerosis 2 (juvenile) (Als2), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Als2 (74018)
Length:
2977
CDS:
136..2922

Additional Resources:

NCBI RefSeq record:
NM_146109.3
NBCI Gene record:
Als2 (74018)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_146109.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000041032 CCCGTCATTAGCAGTTAGGAT pLKO.1 570 CDS 100% 3.000 2.400 N Als2 n/a
2 TRCN0000316882 CCCGTCATTAGCAGTTAGGAT pLKO_005 570 CDS 100% 3.000 2.400 N Als2 n/a
3 TRCN0000041029 CCTGCCATTGATTTCCTAAAT pLKO.1 2527 CDS 100% 13.200 9.240 N Als2 n/a
4 TRCN0000316814 CCTGCCATTGATTTCCTAAAT pLKO_005 2527 CDS 100% 13.200 9.240 N Als2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_146109.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.