Transcript: Mouse NM_146131.2

Mus musculus pre B cell leukemia transcription factor interacting protein 1 (Pbxip1), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Pbxip1 (229534)
Length:
4481
CDS:
112..2295

Additional Resources:

NCBI RefSeq record:
NM_146131.2
NBCI Gene record:
Pbxip1 (229534)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_146131.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000081952 CGGACGAATCTGGGAGCAGAA pLKO.1 1682 CDS 100% 1.350 1.080 N Pbxip1 n/a
2 TRCN0000081948 GCTCAAGATGCCTGGAGTTAT pLKO.1 2336 3UTR 100% 13.200 9.240 N Pbxip1 n/a
3 TRCN0000422289 AGATCCATCCACAGAACTTAC pLKO_005 476 CDS 100% 10.800 7.560 N Pbxip1 n/a
4 TRCN0000417570 ATAAAGGCCCTGGGTACTAAG pLKO_005 2561 3UTR 100% 10.800 7.560 N Pbxip1 n/a
5 TRCN0000421436 ATGATGAAGTGGATGACTTTG pLKO_005 2132 CDS 100% 10.800 7.560 N Pbxip1 n/a
6 TRCN0000081950 CCAGCTTATTGGAGCAGCATA pLKO.1 1244 CDS 100% 4.950 3.465 N Pbxip1 n/a
7 TRCN0000081949 CCTGAAGAAGAGGTCACGAAA pLKO.1 2190 CDS 100% 4.950 3.465 N Pbxip1 n/a
8 TRCN0000081951 CCTGCTTACTTTGGAGAAGAT pLKO.1 2017 CDS 100% 4.950 3.465 N Pbxip1 n/a
9 TRCN0000015075 GCTGGGCATCTCCCTCAACAT pLKO.1 669 CDS 100% 1.650 1.155 N PBXIP1 n/a
10 TRCN0000413379 AGGATGGCAAGGCCACTAAAG pLKO_005 1193 CDS 100% 10.800 6.480 N Pbxip1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_146131.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.