Transcript: Mouse NM_146141.2

Mus musculus pyrophosphatase (inorganic) 2 (Ppa2), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-04
Taxon:
Mus musculus (mouse)
Gene:
Ppa2 (74776)
Length:
1383
CDS:
31..1023

Additional Resources:

NCBI RefSeq record:
NM_146141.2
NBCI Gene record:
Ppa2 (74776)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_146141.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000114162 GCAAGATATAAAGAACGGAAA pLKO.1 369 CDS 100% 4.050 5.670 N Ppa2 n/a
2 TRCN0000334873 GCAAGATATAAAGAACGGAAA pLKO_005 369 CDS 100% 4.050 5.670 N Ppa2 n/a
3 TRCN0000114163 CCTTGGGACTTTGGCACTTAT pLKO.1 579 CDS 100% 13.200 9.240 N Ppa2 n/a
4 TRCN0000334797 CCTTGGGACTTTGGCACTTAT pLKO_005 579 CDS 100% 13.200 9.240 N Ppa2 n/a
5 TRCN0000114161 CGTCTGTGAAATAGGCTCAAA pLKO.1 522 CDS 100% 4.950 3.465 N Ppa2 n/a
6 TRCN0000334836 CGTCTGTGAAATAGGCTCAAA pLKO_005 522 CDS 100% 4.950 3.465 N Ppa2 n/a
7 TRCN0000114164 GACGTTATTAACTCTGCACAT pLKO.1 811 CDS 100% 4.050 2.835 N Ppa2 n/a
8 TRCN0000114165 CGACGTTATTAACTCTGCACA pLKO.1 810 CDS 100% 2.640 1.848 N Ppa2 n/a
9 TRCN0000334875 CGACGTTATTAACTCTGCACA pLKO_005 810 CDS 100% 2.640 1.848 N Ppa2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_146141.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.