Transcript: Mouse NM_146251.4

Mus musculus patatin-like phospholipase domain containing 7 (Pnpla7), mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Pnpla7 (241274)
Length:
4592
CDS:
252..4310

Additional Resources:

NCBI RefSeq record:
NM_146251.4
NBCI Gene record:
Pnpla7 (241274)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_146251.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000086306 CCAAGAGGATTCTGCGCTTTA pLKO.1 610 CDS 100% 10.800 8.640 N Pnpla7 n/a
2 TRCN0000301876 CCAAGAGGATTCTGCGCTTTA pLKO_005 610 CDS 100% 10.800 8.640 N Pnpla7 n/a
3 TRCN0000086307 CATGTCCTTGTCAGGCTATAT pLKO.1 3497 CDS 100% 13.200 9.240 N Pnpla7 n/a
4 TRCN0000301872 CATGTCCTTGTCAGGCTATAT pLKO_005 3497 CDS 100% 13.200 9.240 N Pnpla7 n/a
5 TRCN0000086303 CCCATTCCTTAGAGGCTACTT pLKO.1 4361 3UTR 100% 4.950 3.465 N Pnpla7 n/a
6 TRCN0000301942 CCCATTCCTTAGAGGCTACTT pLKO_005 4361 3UTR 100% 4.950 3.465 N Pnpla7 n/a
7 TRCN0000086305 CGGGTGGCATTTCTTCATGTT pLKO.1 1737 CDS 100% 4.950 3.465 N Pnpla7 n/a
8 TRCN0000301875 CGGGTGGCATTTCTTCATGTT pLKO_005 1737 CDS 100% 4.950 3.465 N Pnpla7 n/a
9 TRCN0000086304 GCAGCTAATCTTGCTGCACAA pLKO.1 2864 CDS 100% 0.405 0.284 N Pnpla7 n/a
10 TRCN0000301874 GCAGCTAATCTTGCTGCACAA pLKO_005 2864 CDS 100% 0.405 0.284 N Pnpla7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_146251.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.