Transcript: Mouse NM_146335.1

Mus musculus olfactory receptor 19 (Olfr19), mRNA.

Source:
NCBI, updated 2017-04-15
Taxon:
Mus musculus (mouse)
Gene:
Olfr19 (18316)
Length:
930
CDS:
1..930

Additional Resources:

NCBI RefSeq record:
NM_146335.1
NBCI Gene record:
Olfr19 (18316)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_146335.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000202780 CCACTTTGTTTGTGAGCTTAA pLKO.1 525 CDS 100% 10.800 7.560 N Olfr19 n/a
2 TRCN0000203073 GTGATGTACTTTGCAGCTATA pLKO.1 592 CDS 100% 10.800 7.560 N Olfr19 n/a
3 TRCN0000186114 CCATACGTGCAATCTCATCAT pLKO.1 671 CDS 100% 4.950 3.465 N Olfr19 n/a
4 TRCN0000203313 GAGCTTAATCAACTGGTACTA pLKO.1 538 CDS 100% 4.950 3.465 N Olfr19 n/a
5 TRCN0000187725 GCCACCATTACAGATTCCCAT pLKO.1 142 CDS 100% 2.640 1.848 N Olfr19 n/a
6 TRCN0000009438 AGTTTCCTCCATACGTGCAAT pLKO.1 663 CDS 100% 4.950 2.970 N OR7A17 n/a
7 TRCN0000197365 CCTCCATACGTGCAATCTCAT pLKO.1 668 CDS 100% 4.950 2.970 N OR7A10 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_146335.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.