Transcript: Mouse NM_146386.3

Mus musculus myocardin (Myocd), transcript variant B, mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Myocd (214384)
Length:
4983
CDS:
292..3099

Additional Resources:

NCBI RefSeq record:
NM_146386.3
NBCI Gene record:
Myocd (214384)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_146386.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000423299 TTCCGTGAAAGAGGCTATAAA pLKO_005 684 CDS 100% 15.000 21.000 N Myocd n/a
2 TRCN0000428249 CAAACAGAAGTCAGCTATTAA pLKO_005 3251 3UTR 100% 15.000 10.500 N Myocd n/a
3 TRCN0000085243 CCTCATTGAAAGTGGAGAAAT pLKO.1 2511 CDS 100% 13.200 9.240 N Myocd n/a
4 TRCN0000085247 CCTTTGAGGATGACAGCAGTA pLKO.1 746 CDS 100% 4.050 2.835 N Myocd n/a
5 TRCN0000085246 TCACGGAATCTCCTTGGGAAA pLKO.1 2927 CDS 100% 4.050 2.835 N Myocd n/a
6 TRCN0000426095 CCAACACCTTGCCCAGTTATC pLKO_005 1598 CDS 100% 10.800 6.480 N Myocd n/a
7 TRCN0000085244 CCAAAGGTGAAGAAGCTCAAA pLKO.1 1051 CDS 100% 4.950 2.475 Y Myocd n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_146386.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.