Transcript: Mouse NM_146485.2

Mus musculus olfactory receptor 183 (Olfr183), mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Olfr183 (258478)
Length:
1196
CDS:
267..1196

Additional Resources:

NCBI RefSeq record:
NM_146485.2
NBCI Gene record:
Olfr183 (258478)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_146485.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000202786 CACCTCTTGTCTGTATCTTTA pLKO.1 996 CDS 100% 13.200 9.240 N Olfr183 n/a
2 TRCN0000202508 CCTGTACTGATCCTTCTTTAA pLKO.1 829 CDS 100% 13.200 9.240 N Olfr183 n/a
3 TRCN0000186702 GCCTTTGTGGATACATGGTTA pLKO.1 465 CDS 100% 4.950 3.465 N Olfr183 n/a
4 TRCN0000185408 GCTATTTAATCTCTTGGACAA pLKO.1 509 CDS 100% 4.050 2.835 N Olfr183 n/a
5 TRCN0000184859 CCTTATCATTTATAGGTGGCT pLKO.1 703 CDS 100% 0.660 0.462 N Olfr183 n/a
6 TRCN0000184846 CCTTCTGTAATTCCAACATAA pLKO.1 766 CDS 100% 13.200 6.600 Y OR5H6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_146485.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.