Transcript: Mouse NM_146654.1

Mus musculus olfactory receptor 237, pseudogene 1 (Olfr237-ps1), mRNA.

Source:
NCBI, updated 2013-04-17
Taxon:
Mus musculus (mouse)
Gene:
Olfr237-ps1 (258648)
Length:
933
CDS:
1..933

Additional Resources:

NCBI RefSeq record:
NM_146654.1
NBCI Gene record:
Olfr237-ps1 (258648)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_146654.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000203953 CTCACATAGAGTGCCTGATTT pLKO.1 320 CDS 100% 13.200 9.240 N Olfr237-ps1 n/a
2 TRCN0000185299 GAATGGAATCATCTTTGGAAT pLKO.1 120 CDS 100% 4.950 3.465 N Olfr237-ps1 n/a
3 TRCN0000186510 GTGATGTCCTATGATAGGTTT pLKO.1 346 CDS 100% 4.950 2.970 N Olfr237-ps1 n/a
4 TRCN0000185847 GCAGCTTGTGTGTTCATATTA pLKO.1 598 CDS 100% 15.000 7.500 Y Olfr434 n/a
5 TRCN0000185043 CAATCACTTCTTCTGTGAAAT pLKO.1 519 CDS 100% 13.200 6.600 Y Olfr434 n/a
6 TRCN0000184899 CAACACTCAATCAAGTTGTTA pLKO.1 572 CDS 100% 5.625 2.813 Y Olfr435 n/a
7 TRCN0000185609 GACACAACACTCAATCAAGTT pLKO.1 568 CDS 100% 4.950 2.475 Y Olfr441 n/a
8 TRCN0000186815 GCCATTGTTGACATGTCCTAT pLKO.1 196 CDS 100% 4.950 2.475 Y Olfr441 n/a
9 TRCN0000187562 GCCTCATGAAGTCAATCACTT pLKO.1 507 CDS 100% 4.950 2.475 Y Olfr237-ps1 n/a
10 TRCN0000185680 GTCAATCACTTCTTCTGTGAA pLKO.1 517 CDS 100% 4.950 2.475 Y Olfr441 n/a
11 TRCN0000189182 CCCATGTACTTCTTCCTCTCT pLKO.1 169 CDS 100% 2.640 1.320 Y Olfr444 n/a
12 TRCN0000203811 CTTCTGTGAAATCCTGTCTGT pLKO.1 528 CDS 100% 2.640 1.320 Y OR2A42 n/a
13 TRCN0000009348 CCCATGTACTTCTTCCTCTCA pLKO.1 169 CDS 100% 2.640 1.320 Y OR2A4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_146654.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.