Transcript: Mouse NM_146826.1

Mus musculus olfactory receptor 969 (Olfr969), mRNA.

Source:
NCBI, updated 2012-08-25
Taxon:
Mus musculus (mouse)
Gene:
Olfr969 (258823)
Length:
936
CDS:
1..936

Additional Resources:

NCBI RefSeq record:
NM_146826.1
NBCI Gene record:
Olfr969 (258823)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_146826.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000204810 GCCATCTTCGGTCAACTCTAT pLKO.1 783 CDS 100% 4.950 6.930 N Olfr969 n/a
2 TRCN0000203080 GAGTCTGTTCTTGGATGATAT pLKO.1 416 CDS 100% 13.200 9.240 N Olfr969 n/a
3 TRCN0000203104 GTGCATTTCTGTAAGACTGAT pLKO.1 496 CDS 100% 4.950 3.465 N Olfr969 n/a
4 TRCN0000185817 GATATTTATCCACTACTGGAA pLKO.1 538 CDS 100% 2.640 1.848 N Olfr969 n/a
5 TRCN0000185860 GCATGATCACTCTGATACTAT pLKO.1 131 CDS 100% 5.625 3.375 N Olfr969 n/a
6 TRCN0000204567 CTCAGCAGTCTGTCCTTCATT pLKO.1 187 CDS 100% 5.625 2.813 Y Olfr1537 n/a
7 TRCN0000185212 CTGATACTATTCAGTTCTCAA pLKO.1 142 CDS 100% 4.950 2.475 Y Olfr968 n/a
8 TRCN0000203180 GTGAAGAACATCATCTCCTAT pLKO.1 262 CDS 100% 4.950 2.475 Y Olfr970 n/a
9 TRCN0000186512 GTCCACTGTCATTATTCCCAA pLKO.1 219 CDS 100% 2.640 1.320 Y Olfr969 n/a
10 TRCN0000203892 CCTTCATTGACCTCTGCCATT pLKO.1 200 CDS 100% 4.050 2.025 Y Olfr971 n/a
11 TRCN0000185264 GCTCTTACATCTTCATCATTA pLKO.1 647 CDS 100% 13.200 6.600 Y Olfr955 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_146826.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.