Transcript: Mouse NM_146898.2

Mus musculus olfactory receptor 1213 (Olfr1213), mRNA.

Source:
NCBI, updated 2017-05-12
Taxon:
Mus musculus (mouse)
Gene:
Olfr1213 (258900)
Length:
1297
CDS:
362..1297

Additional Resources:

NCBI RefSeq record:
NM_146898.2
NBCI Gene record:
Olfr1213 (258900)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_146898.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000030341 GTAACTGTGGACTTGCTTTAT pLKO.1 599 CDS 100% 13.200 7.920 N Olfr1213 n/a
2 TRCN0000030339 GTAGAGGTGATTGTCTTGATA pLKO.1 686 CDS 100% 5.625 3.375 N Olfr1213 n/a
3 TRCN0000030342 CCCTTGTACTACTCTTCCATT pLKO.1 743 CDS 100% 4.950 2.970 N Olfr1213 n/a
4 TRCN0000030340 CTGTCATCACACCAAAGGTAA pLKO.1 582 CDS 100% 4.950 2.970 N Olfr1213 n/a
5 TRCN0000030343 GCAACATGATAATTGTGGTAA pLKO.1 477 CDS 100% 4.950 2.475 Y Olfr1213 n/a
6 TRCN0000220987 CCCACATTACTGTTGTGGTTT pLKO.1 1083 CDS 100% 0.495 0.248 Y Olfr1215 n/a
7 TRCN0000030353 CATGTACTTCTTCTTGGCATT pLKO.1 532 CDS 100% 4.050 2.025 Y Olfr1217 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_146898.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.