Transcript: Mouse NM_146924.1

Mus musculus olfactory receptor 476 (Olfr476), mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Olfr476 (258926)
Length:
933
CDS:
1..933

Additional Resources:

NCBI RefSeq record:
NM_146924.1
NBCI Gene record:
Olfr476 (258926)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_146924.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000187970 CCACATCAATCACACCAACAA pLKO.1 221 CDS 100% 4.950 3.465 N Olfr476 n/a
2 TRCN0000203165 GTCTCCATCATTGGAATTATT pLKO.1 574 CDS 100% 15.000 9.000 N Olfr476 n/a
3 TRCN0000202617 CGTGTCATCCTATTTATGGTA pLKO.1 70 CDS 100% 3.000 1.800 N Olfr476 n/a
4 TRCN0000189320 CGCCTACATTCTCATCACCAT pLKO.1 654 CDS 100% 2.640 1.584 N Olfr476 n/a
5 TRCN0000185221 CCAAATCAGATAGATCACTTT pLKO.1 511 CDS 100% 4.950 2.475 Y Olfr476 n/a
6 TRCN0000186261 CTATGGAACCATTACCTTCAT pLKO.1 753 CDS 100% 4.950 2.475 Y Olfr477 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_146924.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.