Transcript: Mouse NM_146938.1

Mus musculus olfactory receptor 346 (Olfr346), mRNA.

Source:
NCBI, updated 2012-08-25
Taxon:
Mus musculus (mouse)
Gene:
Olfr346 (258940)
Length:
930
CDS:
1..930

Additional Resources:

NCBI RefSeq record:
NM_146938.1
NBCI Gene record:
Olfr346 (258940)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_146938.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000204564 CTGCCTTGCTTAAGCTGTCAA pLKO.1 545 CDS 100% 4.950 3.465 N Olfr346 n/a
2 TRCN0000203273 GCCTTATCTTTAGTCAATGCT pLKO.1 448 CDS 100% 3.000 2.100 N Olfr346 n/a
3 TRCN0000189376 CCTCATCATGAACCTGAACCT pLKO.1 399 CDS 100% 2.640 1.848 N Olfr346 n/a
4 TRCN0000203367 CTGGTCTCTTATGGCTACATT pLKO.1 643 CDS 100% 5.625 3.375 N Olfr346 n/a
5 TRCN0000186992 CAGCATCAATGAGCTTGTCAT pLKO.1 576 CDS 100% 4.950 2.970 N Olfr346 n/a
6 TRCN0000204764 GCTGACACAAAGTCAGTCCAT pLKO.1 255 CDS 100% 0.264 0.158 N Olfr346 n/a
7 TRCN0000184960 CCTATCTCACTTTAGAAACAA pLKO.1 495 CDS 100% 5.625 2.813 Y Olfr346 n/a
8 TRCN0000204867 GTACTTCTTCCTCAGCCACTT pLKO.1 177 CDS 100% 4.050 2.025 Y Olfr339 n/a
9 TRCN0000060371 CCATGTACTTCTTCCTCAGAA pLKO.1 173 CDS 100% 4.950 2.475 Y OR10A2 n/a
10 TRCN0000188492 CCCATGTACTTCTTCCTCACA pLKO.1 172 CDS 100% 2.640 1.320 Y Olfr317 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_146938.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.