Transcript: Mouse NM_146940.1

Mus musculus olfactory receptor 352 (Olfr352), mRNA.

Source:
NCBI, updated 2012-08-25
Taxon:
Mus musculus (mouse)
Gene:
Olfr352 (258942)
Length:
948
CDS:
1..948

Additional Resources:

NCBI RefSeq record:
NM_146940.1
NBCI Gene record:
Olfr352 (258942)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_146940.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000185575 CCTTCACCTAATAACAGTAAT pLKO.1 793 CDS 100% 13.200 18.480 N Olfr352 n/a
2 TRCN0000202684 CCATTAACGAACTGGTTATCT pLKO.1 587 CDS 100% 5.625 7.875 N Olfr352 n/a
3 TRCN0000203356 CATCTCATATACGGGATGCAT pLKO.1 282 CDS 100% 3.000 4.200 N Olfr352 n/a
4 TRCN0000185140 CTCTGTGTACTACTGTTAATT pLKO.1 427 CDS 100% 15.000 10.500 N Olfr352 n/a
5 TRCN0000185022 CTGTGCCATTGATATGTATTT pLKO.1 632 CDS 100% 13.200 9.240 N Olfr352 n/a
6 TRCN0000185390 GCCATTATTGGGTTATACTCT pLKO.1 769 CDS 100% 3.000 1.800 N Olfr352 n/a
7 TRCN0000204031 GCTCCAAAGATGCTCGTGAAT pLKO.1 241 CDS 100% 4.950 2.475 Y Olfr352 n/a
8 TRCN0000204867 GTACTTCTTCCTCAGCCACTT pLKO.1 186 CDS 100% 4.050 2.025 Y Olfr339 n/a
9 TRCN0000060371 CCATGTACTTCTTCCTCAGAA pLKO.1 182 CDS 100% 4.950 2.475 Y OR10A2 n/a
10 TRCN0000188492 CCCATGTACTTCTTCCTCACA pLKO.1 181 CDS 100% 2.640 1.320 Y Olfr317 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_146940.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.