Transcript: Mouse NM_146951.1

Mus musculus olfactory receptor 340 (Olfr340), mRNA.

Source:
NCBI, updated 2013-04-17
Taxon:
Mus musculus (mouse)
Gene:
Olfr340 (258953)
Length:
939
CDS:
1..939

Additional Resources:

NCBI RefSeq record:
NM_146951.1
NBCI Gene record:
Olfr340 (258953)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_146951.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000185576 CTTGGTACAACTATCTTACTT pLKO.1 486 CDS 100% 5.625 7.875 N Olfr340 n/a
2 TRCN0000204845 GCCACATTGGTGTCACCATTA pLKO.1 656 CDS 100% 10.800 6.480 N Olfr340 n/a
3 TRCN0000188734 GCTGACACACAGTCAATCCAT pLKO.1 255 CDS 100% 3.000 1.800 N Olfr340 n/a
4 TRCN0000185547 GAGCCATCATTGGACTATATT pLKO.1 758 CDS 100% 15.000 7.500 Y Olfr347 n/a
5 TRCN0000203447 CACAGTCAATCCATCTCATAT pLKO.1 262 CDS 100% 13.200 6.600 Y Olfr348 n/a
6 TRCN0000186263 CCTCTGCACTATTCACAAATT pLKO.1 385 CDS 100% 13.200 6.600 Y Olfr340 n/a
7 TRCN0000188261 CACCCTCTGCACTATTCACAA pLKO.1 382 CDS 100% 4.950 2.475 Y Olfr345 n/a
8 TRCN0000188079 CCTGCTCATCATCCTACTCAT pLKO.1 126 CDS 100% 4.950 2.475 Y Olfr350 n/a
9 TRCN0000187565 GCCATTCATATGCATTCTGGT pLKO.1 627 CDS 100% 0.000 0.000 Y Olfr340 n/a
10 TRCN0000187337 CCTTGTACTATGGAGCCATAA pLKO.1 746 CDS 100% 10.800 5.400 Y Olfr342 n/a
11 TRCN0000188126 CATCTCATATGCTGGGTGTAT pLKO.1 273 CDS 100% 0.000 0.000 Y Olfr338 n/a
12 TRCN0000060371 CCATGTACTTCTTCCTCAGAA pLKO.1 173 CDS 100% 4.950 2.475 Y OR10A2 n/a
13 TRCN0000188492 CCCATGTACTTCTTCCTCACA pLKO.1 172 CDS 100% 2.640 1.320 Y Olfr317 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_146951.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.