Transcript: Mouse NM_147026.1

Mus musculus olfactory receptor 532 (Olfr532), mRNA.

Source:
NCBI, updated 2012-08-25
Taxon:
Mus musculus (mouse)
Gene:
Olfr532 (259028)
Length:
930
CDS:
1..930

Additional Resources:

NCBI RefSeq record:
NM_147026.1
NBCI Gene record:
Olfr532 (259028)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_147026.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000188520 CCTGTACTACTCCACCATCAT pLKO.1 747 CDS 100% 4.950 2.970 N Olfr532 n/a
2 TRCN0000346117 GGCTTCACACACCCATGTATT pLKO_005 161 CDS 100% 13.200 6.600 Y Olfr715b n/a
3 TRCN0000188475 CCAACCACCCTCAACAACATT pLKO.1 571 CDS 100% 5.625 2.813 Y Olfr532 n/a
4 TRCN0000202887 CTGTTGACTATGATATCCTAT pLKO.1 634 CDS 100% 4.950 2.475 Y Olfr525 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_147026.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.