Transcript: Mouse NM_147220.2

Mus musculus ATP-binding cassette, sub-family A (ABC1), member 9 (Abca9), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Abca9 (217262)
Length:
6268
CDS:
254..5125

Additional Resources:

NCBI RefSeq record:
NM_147220.2
NBCI Gene record:
Abca9 (217262)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_147220.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000113443 GCTATCATCTAAGTTTGCATT pLKO.1 2382 CDS 100% 4.950 3.960 N Abca9 n/a
2 TRCN0000113440 CGGTGTGCAAACAGCTTAGAA pLKO.1 5209 3UTR 100% 5.625 3.938 N Abca9 n/a
3 TRCN0000113441 GCAGAGTAATTGTCTTCAGTA pLKO.1 2250 CDS 100% 4.950 3.465 N Abca9 n/a
4 TRCN0000113444 GCATGATAACAGGAGACACAA pLKO.1 4260 CDS 100% 4.950 3.465 N Abca9 n/a
5 TRCN0000113442 GCCTGTTGATTCAGATCCCAT pLKO.1 3558 CDS 100% 2.640 1.848 N Abca9 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_147220.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.