Transcript: Mouse NM_147222.2

Mus musculus retinol dehydrogenase 19 (Rdh19), mRNA.

Source:
NCBI, updated 2015-02-15
Taxon:
Mus musculus (mouse)
Gene:
Rdh19 (216453)
Length:
1889
CDS:
94..1050

Additional Resources:

NCBI RefSeq record:
NM_147222.2
NBCI Gene record:
Rdh19 (216453)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_147222.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000041442 GTGCCCGATTATCCTCAAATA pLKO.1 743 CDS 100% 13.200 9.240 N Rdh19 n/a
2 TRCN0000041438 CGAGTGTCACTTCATGGTAAT pLKO.1 595 CDS 100% 10.800 7.560 N Rdh19 n/a
3 TRCN0000041440 ACTTCATGGTAATGGTGGTTA pLKO.1 603 CDS 100% 4.950 3.465 N Rdh19 n/a
4 TRCN0000049471 CCTCCAAGACAAGTATGTCTT pLKO.1 171 CDS 100% 0.495 0.297 N HSD17B6 n/a
5 TRCN0000292061 CCTCCAAGACAAGTATGTCTT pLKO_005 171 CDS 100% 0.495 0.297 N HSD17B6 n/a
6 TRCN0000445030 GGGTGAAGGTGGCTATTATAG pLKO_005 689 CDS 100% 13.200 6.600 Y Rdh16 n/a
7 TRCN0000041441 CCTTTCTTGTGGATGCTGTTT pLKO.1 992 CDS 100% 4.950 2.475 Y Rdh19 n/a
8 TRCN0000041946 CAGCTCAGAAATCAGGGAGAT pLKO.1 786 CDS 100% 4.050 2.025 Y Rdh16 n/a
9 TRCN0000190157 GCTGAGGAACAAGACATCTGA pLKO.1 297 CDS 100% 3.000 1.500 Y Rdh18-ps n/a
10 TRCN0000202357 GAACAAGACATCTGACAGGCT pLKO.1 303 CDS 100% 0.660 0.330 Y Rdh18-ps n/a
11 TRCN0000041439 CCAAGACAAGTATGTCTTCAT pLKO.1 174 CDS 100% 0.495 0.248 Y Rdh19 n/a
12 TRCN0000191364 CAAACAGAACTTTGCAAGTAT pLKO.1 471 CDS 100% 5.625 2.813 Y Rdh18-ps n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_147222.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.