Transcript: Mouse NM_148413.3

Mus musculus myosin IIIA (Myo3a), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Myo3a (667663)
Length:
5082
CDS:
134..4999

Additional Resources:

NCBI RefSeq record:
NM_148413.3
NBCI Gene record:
Myo3a (667663)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_148413.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000025345 CGGATACTCTTCGCTAACTTT pLKO.1 3125 CDS 100% 5.625 7.875 N Myo3a n/a
2 TRCN0000025347 CGCCATCTTGAACGTTGGAAA pLKO.1 1963 CDS 100% 4.950 3.960 N Myo3a n/a
3 TRCN0000025346 CCAGAGTTACTGTCAGTGGTA pLKO.1 3871 CDS 100% 2.640 2.112 N Myo3a n/a
4 TRCN0000226055 ACAGAATCAAGAGCTATATAT pLKO_005 3748 CDS 100% 15.000 10.500 N Myo3a n/a
5 TRCN0000226052 CAGACCAGTGCATCGTTATTT pLKO_005 1425 CDS 100% 15.000 10.500 N Myo3a n/a
6 TRCN0000218991 GATACTCCTTGATGGATTTAT pLKO_005 2946 CDS 100% 15.000 10.500 N Myo3a n/a
7 TRCN0000226054 GGATACTCTTCGCTAACTTTA pLKO_005 3126 CDS 100% 13.200 9.240 N Myo3a n/a
8 TRCN0000025344 GCAGAGTTCAATGACTTCATT pLKO.1 929 CDS 100% 5.625 3.938 N Myo3a n/a
9 TRCN0000025348 GCGTGGGATTTAGCAATGTTT pLKO.1 4412 CDS 100% 5.625 3.938 N Myo3a n/a
10 TRCN0000226053 GGCAATGCCTGCACTATTATA pLKO_005 1577 CDS 100% 15.000 9.000 N Myo3a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_148413.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.