Transcript: Mouse NM_148917.2

Mus musculus poly(A) binding protein, cytoplasmic 4 (Pabpc4), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-26
Taxon:
Mus musculus (mouse)
Gene:
Pabpc4 (230721)
Length:
2500
CDS:
331..2178

Additional Resources:

NCBI RefSeq record:
NM_148917.2
NBCI Gene record:
Pabpc4 (230721)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_148917.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000102378 GCCAGTTTGGTAAGACCCTAA pLKO.1 965 CDS 100% 4.050 5.670 N Pabpc4 n/a
2 TRCN0000102375 CCAGCTAAGGTCTGAAGACAT pLKO.1 2222 3UTR 100% 4.950 3.465 N Pabpc4 n/a
3 TRCN0000102376 CCTGGACAAATCCATAGACAA pLKO.1 645 CDS 100% 4.950 3.465 N Pabpc4 n/a
4 TRCN0000102377 GCGAAGGTGATGCTAGAAGAT pLKO.1 1297 CDS 100% 4.950 3.465 N Pabpc4 n/a
5 TRCN0000102379 CCAAGGAATTCACCAATGTTT pLKO.1 890 CDS 100% 0.000 0.000 N Pabpc4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_148917.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.