Transcript: Human NM_152231.1

Homo sapiens F-box protein 34 (FBXO34), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-04
Taxon:
Homo sapiens (human)
Gene:
FBXO34 (55030)
Length:
2831
CDS:
139..2274

Additional Resources:

NCBI RefSeq record:
NM_152231.1
NBCI Gene record:
FBXO34 (55030)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_152231.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000295901 GTCAGCACTTGTCAGACTATT pLKO_005 1601 CDS 100% 13.200 18.480 N FBXO34 n/a
2 TRCN0000073292 CGGTAAAGCATCATCTCGAAA pLKO.1 297 CDS 100% 4.950 6.930 N FBXO34 n/a
3 TRCN0000288689 CGGTAAAGCATCATCTCGAAA pLKO_005 297 CDS 100% 4.950 6.930 N FBXO34 n/a
4 TRCN0000073289 CCACAGCTTTAATCGGGCAAT pLKO.1 2211 CDS 100% 4.050 5.670 N FBXO34 n/a
5 TRCN0000288691 CCACAGCTTTAATCGGGCAAT pLKO_005 2211 CDS 100% 4.050 5.670 N FBXO34 n/a
6 TRCN0000295853 ACCTAGATACACCGTTCAAAT pLKO_005 2323 3UTR 100% 13.200 10.560 N FBXO34 n/a
7 TRCN0000073290 CCACATAACATCAAGTGTCTT pLKO.1 261 CDS 100% 4.950 3.465 N FBXO34 n/a
8 TRCN0000073288 GCTGTGAATAACTGCCTGTTT pLKO.1 2517 3UTR 100% 4.950 3.465 N FBXO34 n/a
9 TRCN0000073291 CCAAGAGTTTAGTGGCCCTTA pLKO.1 1913 CDS 100% 4.050 2.835 N FBXO34 n/a
10 TRCN0000288690 CCAAGAGTTTAGTGGCCCTTA pLKO_005 1913 CDS 100% 4.050 2.835 N FBXO34 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_152231.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03509 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_03509 pLX_304 0% 100% 100% V5 n/a
3 ccsbBroadEn_08458 pDONR223 100% 99.8% 99.7% None 600T>C;1409T>A;1598T>C n/a
4 ccsbBroad304_08458 pLX_304 0% 99.8% 99.7% V5 600T>C;1409T>A;1598T>C n/a
Download CSV