Transcript: Human NM_152278.5

Homo sapiens transcription elongation factor A like 7 (TCEAL7), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-26
Taxon:
Homo sapiens (human)
Gene:
TCEAL7 (56849)
Length:
1134
CDS:
212..514

Additional Resources:

NCBI RefSeq record:
NM_152278.5
NBCI Gene record:
TCEAL7 (56849)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_152278.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000146340 CTTCAGTCTCTCGAAGAATTT pLKO.1 335 CDS 100% 13.200 9.240 N TCEAL7 n/a
2 TRCN0000147295 GCAAAGGAAAGTGTCTGATTT pLKO.1 826 3UTR 100% 13.200 9.240 N TCEAL7 n/a
3 TRCN0000430087 TTGACCCAATCTTATTCATTT pLKO_005 668 3UTR 100% 13.200 9.240 N TCEAL7 n/a
4 TRCN0000426793 GATGAGATGGAAAGGTGTTTG pLKO_005 410 CDS 100% 10.800 7.560 N TCEAL7 n/a
5 TRCN0000256701 TTTAGGGCTCTGCATTCTAAC pLKO_005 458 CDS 100% 10.800 7.560 N Tceal7 n/a
6 TRCN0000414263 AGAATTTGAACGCCAGCAAAC pLKO_005 289 CDS 100% 6.000 4.200 N TCEAL7 n/a
7 TRCN0000428695 GAAATTTAGGGCTCTGCATTC pLKO_005 454 CDS 100% 6.000 4.200 N TCEAL7 n/a
8 TRCN0000183785 CGAAGAATTTAAAGAGGACAT pLKO.1 346 CDS 100% 4.050 2.835 N TCEAL7 n/a
9 TRCN0000416871 AGGTGTTTGGAAGAGATAAGG pLKO_005 422 CDS 100% 4.950 2.970 N TCEAL7 n/a
10 TRCN0000180200 CTGCTTCAGTCTCTCGAAGAA pLKO.1 332 CDS 100% 4.950 2.970 N TCEAL7 n/a
11 TRCN0000178791 CTGCATTCTAACCATAGGCAT pLKO.1 467 CDS 100% 2.640 1.584 N TCEAL7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_152278.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03744 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_03744 pLX_304 0% 100% 100% V5 n/a
Download CSV