Transcript: Human NM_152352.4

Homo sapiens family with sequence similarity 210 member A (FAM210A), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
FAM210A (125228)
Length:
4210
CDS:
259..1077

Additional Resources:

NCBI RefSeq record:
NM_152352.4
NBCI Gene record:
FAM210A (125228)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_152352.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000236297 TTGCAACACCTGCTCGGTATA pLKO_005 845 CDS 100% 10.800 15.120 N FAM210A n/a
2 TRCN0000121597 CCACATAATGCTGGTCTCTTT pLKO.1 316 CDS 100% 4.950 6.930 N FAM210A n/a
3 TRCN0000122467 GCCTGATCCTTTGCAAGACAA pLKO.1 591 CDS 100% 4.950 6.930 N FAM210A n/a
4 TRCN0000122560 CCCTTTGGAAACTATGGGCAA pLKO.1 1118 3UTR 100% 2.160 3.024 N FAM210A n/a
5 TRCN0000236299 ATGTTGAGTTTGGAGTATTAA pLKO_005 3505 3UTR 100% 15.000 10.500 N FAM210A n/a
6 TRCN0000236301 ACGATTCAAGAAGACATTTAG pLKO_005 630 CDS 100% 13.200 9.240 N FAM210A n/a
7 TRCN0000236298 GACATGCTTGGAACCACATAA pLKO_005 303 CDS 100% 13.200 9.240 N FAM210A n/a
8 TRCN0000236300 TCTGATTCCAGTGCATCTAAT pLKO_005 666 CDS 100% 13.200 9.240 N FAM210A n/a
9 TRCN0000145013 GCAGTATTAAGCAGTGGTTAA pLKO.1 1299 3UTR 100% 10.800 7.560 N FAM210A n/a
10 TRCN0000144892 GCAGTGGTTAATGTCTTAGAA pLKO.1 1309 3UTR 100% 5.625 3.938 N FAM210A n/a
11 TRCN0000140419 GTGAAGTATCTGCGCAGTCAT pLKO.1 895 CDS 100% 4.950 3.465 N FAM210A n/a
12 TRCN0000143857 CATGTTTCATTCAGGAGGGTT pLKO.1 523 CDS 100% 2.640 1.848 N FAM210A n/a
13 TRCN0000144318 CCCAGTTTAAGAATTTGCCAT pLKO.1 1273 3UTR 100% 2.640 1.848 N FAM210A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_152352.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.