Transcript: Human NM_152372.4

Homo sapiens myomesin 3 (MYOM3), mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
MYOM3 (127294)
Length:
5760
CDS:
124..4437

Additional Resources:

NCBI RefSeq record:
NM_152372.4
NBCI Gene record:
MYOM3 (127294)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_152372.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000164064 CGAGAAGAATCGTGCCAAAGT pLKO.1 4110 CDS 100% 4.950 6.930 N MYOM3 n/a
2 TRCN0000162162 CCCTGCCATAAACTGATACAT pLKO.1 4808 3UTR 100% 5.625 4.500 N MYOM3 n/a
3 TRCN0000427258 GACTCAGACAAGGGCAAATAC pLKO_005 3976 CDS 100% 13.200 9.240 N MYOM3 n/a
4 TRCN0000421980 GACACTGGTGGATGACGATTT pLKO_005 3402 CDS 100% 10.800 7.560 N MYOM3 n/a
5 TRCN0000430623 TGGAGAGTGGTGATCGGATAA pLKO_005 3905 CDS 100% 10.800 7.560 N MYOM3 n/a
6 TRCN0000164123 CCCTGAAATCTCTTGGCTGAA pLKO.1 4212 CDS 100% 4.050 2.835 N MYOM3 n/a
7 TRCN0000160710 CGGGAAGAATGAAATGGTCAT pLKO.1 2256 CDS 100% 4.050 2.835 N MYOM3 n/a
8 TRCN0000162080 CAAGGGAATTTACAGAGCGAT pLKO.1 3672 CDS 100% 2.640 1.848 N MYOM3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_152372.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14371 pDONR223 100% 83.4% 46.5% None (many diffs) n/a
2 ccsbBroad304_14371 pLX_304 0% 83.4% 46.5% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV